Some commonly used Sequencing Primers(a) Certify that your chosen sequencing primer is complementary to a site in your plasmid vector (b) Compare a forward against another forward, or a reverse against another reverse, and note the similarities and differences (usually extra nucleotide bases at the 5’ or 3’ ends) (c) What’s most important is to certify that your selected primer is exactly complementary to a target priming site in your plasmid vector, AND WILL PRIME SYNTHESIS TOWARDS YOUR INSERT! (d) full maps with priming target sites for all cloning vectors are available from the vendor’s web-site, or just try a Google with your particular plasmid vector’s name or description Universal Reverse 20mer 5' CACAGGAAACAGCTATGACC 3' Universal Forward 20mer 5' GTTGTAAAACGACGGCCAGT 3' M13 Forward Sequencing Primer (-21) M13 Reverse Sequencing Primer (-28) M13 Forward Primer (-40) M13 Reverse Primer (-29) T7 Promoter Primer SP6 Promoter Primer
|